Things continue to trend in the right direction for Brian Foster after his serious car accident May 1.

His wife has become his full-time carer and says - 'It's like having a young child' ...

Mark Ludlow, 63, was assisting a colleague on a broken lift at a Staffordshire factory when a giant metal rod dropped and ...

A man was left with permanent brain damage after a giant metal bar smashed onto his head while at work – leaving him and his ...

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...

Hereditary axonal peripheral neuropathies comprise a genetically heterogeneous group of disorders that are clinically subsumed under the name of Charcot–Marie–Tooth (CMT) disease type 2 (CMT2).

Presynaptic endocytic machinery is constitutively deployed to periactive zones, indicating independent assembly pathways for the exo- and endocytic machineries of nerve terminals.

We've been independently researching and testing products for over 120 years. If you buy through our links, we may earn a commission. Learn more about our review process. Those with curly hair types ...

Why We Love It: Vitruvi is a popular oil diffuser brand with a loyal fan base, and after trying it ourselves, we can confirm this ceramic model lives up to the hype. Made of sandy, textured ceramic, ...