"With every step we took, we held on and prayed we would make it through to the next one," Alicia Claytor, 35, told Newsweek.
His wife has become his full-time carer and says - 'It's like having a young child' ...
Things continue to trend in the right direction for Brian Foster after his serious car accident May 1.
Mark Ludlow, 63, was assisting a colleague on a broken lift at a Staffordshire factory when a giant metal rod dropped and ...
Stories by SWNS on MSN
Man surviving on £1.3k a month after metal bar struck his face
A man was left with permanent brain damage after a giant metal bar smashed onto his head while at work – leaving him and his ...
Axonal integrity depends on an intact myelin sheath, but the role of the axon in myelin maintenance is more mysterious. A new study reports that preservation of the myelin sheath requires neuronal ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Presynaptic endocytic machinery is constitutively deployed to periactive zones, indicating independent assembly pathways for the exo- and endocytic machineries of nerve terminals.
Why We Love It: Vitruvi is a popular oil diffuser brand with a loyal fan base, and after trying it ourselves, we can confirm this ceramic model lives up to the hype. Made of sandy, textured ceramic, ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results